EMAIL THIS PAGE TO A FRIEND
EHU152131 Sigma-Aldrich

MISSION® esiRNA

esiRNA targeting human SEC13L1 (esiRNA1)

  •  NACRES NA.51

Purchase

Properties

Related Categories Functional Genomics and RNAi, Human esiRNA, MISSION esiRNA Technology, Molecular Biology, RPL-SEM More...
description   Powered by Eupheria Biotech
product line   MISSION®
concentration   200 ng/μL RNA
esiRNA cDNA target sequence   CGTGTGTTCATTTGGACCTGTGATGATGCCTCAAGCAATACGTGGTCCCCTAAATTGTTGCACAAGTTCAACGATGTGGTGTGGCATGTGAGCTGGTCCATCACAGCCAACATCCTGGCTGTCTCTGGTGGAGACAATAAGGTGACCCTGTGGAAGGAGTCAGTTGATGGGCAGTGGGTGTGCATCAGTGATGTCAACAAGGGCCAGGGCTCCGTATCAGCATCAGTGACAGAGGGCCAGCAGAACGAGCAGTGACAAGACAGGTGGGGCCTGGCTCCCCACCCGCCAGCTCCAGGACTGCCCCTTCCTGGGCCAACTAACCAGACAACTGGGAAGAGCCCCCAACTCCAACAGGATTATTTTCCCAGGAGGAGTTACAGATGCAGCCACAGATTGATCA
Ensembl | human accession no.   ENSG00000157020
NCBI accession no.   NM_001136232
  NM_183352
  NR_024272
  NR_024273
shipped in   dry ice
storage temp.   −20°C
Gene Information   human ... SEC13L1(6396)

Description

General description

MISSION esiRNA are endo-ribonuclease prepared siRNA. MISSION esiRNA are a heterogeneous mixture of siRNAs that all target the same mRNA sequence. These multiple silencing triggers lead to highly specific and effective gene silencing.

esiRNA Custom options:
ESISEC: Secondary independent esiRNA for any human or mouse esiRNA
ESIOPEN: Custom esiRNA targeting species specific sequence provided
Contact your local sales rep. or email us at Custom esiRNA for more information.

Other Notes

View the esiRNA screening tutorial.

Physical form

Solution in low-TE (10 mM Tris-HCl, pH 8.0, 1 mM EDTA)

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Safety & Documentation

Safety Information

RIDADR 
NONH for all modes of transport

Documents

Certificate of Analysis

???PDP_SDS_LOT_NUMBER_ERROR_MSG???
Protocols & Articles
Related Products

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?