Coronavirus COVID-19 (SARS-CoV-2) Detection, Characterization, Vaccine and Therapy Production

COVID-19

 Expediting Your COVID-19 Response, Vaccine Research, Therapeutic Development

As a global life science supplier, we are here to help in the response to COVID-19. From supplying raw materials and research products for detection and characterization to production, we’ve consolidated relevant product and service offerings within a single page.

Current events around the spread of COVID-19 and its impact on public health continue to evolve. During this extraordinary time, we are committed to providing researchers, developers and manufacturers with the necessary products and services to aid the COVID-19 response. As such, our top priorities remain the safety and well-being of our employees, meeting the needs of our customers, providing accurate, timely, information, and ensuring business continuity.

We have mobilized a global task force to actively evaluate the overall supply chain of both our products and key raw material suppliers to mitigate any potential disruption. Leveraging business continuity plans, we remain dedicated to supplying our customers in all markets and providing support to the scientific efforts under way around the world, with products and services supporting both the detection of COVID-19 and the development of vaccines and therapies.

This page will be regularly updated with new products and information.
 

 Virus Detection

We are committed to providing researchers with the reagents and technical expertise for timely support of the SARS-CoV-2 outbreak. Explore our offering across viral RNA purification, RT-PCR, RT-qPCR, Immunoassay, and supporting reagents that are suitable for SARS-CoV-2 diagnostics assay development.

See a comprehensive overview of our solutions for Immunoassay and Molecular Dx assay development.
 

 2019-nCoV Coronavirus qPCR Assay Designs and Reagents

Our 2019-nCoV (SARS-CoV-2) qPCR assay designs (see below) are available for immediate ordering from our KiCqStart® product lines.

The following target detection designs are available for open use:
 

Detection Chemistry Forward Reverse Probe
SYBR Green 1 GCCTCTTCTCGTTCCTCATCAC AGCAGCATCACCGCCATTG  
SYBR Green 2 AGCCTCTTCTCGTTCCTCATCAC CCGCCATTGCCAGCCATTC  
Dual-Labeled Probe 1  CCGCAAGGTTCTTCTTCGTAAG TGCTATGTTTAGTGTTCCAGTTTTC AAGGATCAGTGCCAAGCTCGTCGCC
Dual-Labeled Probe 2 GGCTTACCGCAAGGTTCTTC TGCTATGTTTAGTGTTCCAGTTTTC AAGGATCAGTGCCAAGCTCGTCGCC
Dual-Labeled Probe 3 CAGGTATATGCGCTAGTTATCAGAC CCAAGTGACATAGTGTAGGCAATG AGACTAATTCTCCTCGGCGGGCACG
Dual-Labeled Probe 4 GCAGGTATATGCGCTAGTTATCAG ACACTGGTAGAATTTCTGTGGTAAC AGACTAATTCTCCTCGGCGGGCACG


The following SARS positive control assay is available for open use (currently in silico validated only):
 

Detection Chemistry Forward Reverse Probe
Dual-Labeled Probe GCTGTGTGTTTGCCTATGTTGG ACGTTCACGACTCAGTATCTCAAG AGCGTGCCTACTGGGTTCCTCGTGC

 RT-PCR, RT-qPCR Molecular Analysis and Supporting Reagents

We offer a wide variety of PCR reagents, kits and tools to meet your experimental needs at any stage of SARS-CoV-2 assay development. Our products vary from routine to enhanced, so that you find the level of fidelity, speed, and accuracy you need for every PCR assay.

Viral RNA Extraction Kits and Components

The ViralXpress™ nucleic acid extraction kit can be used for the extraction and purification of a broad range of DNA and RNA viruses from a variety of sources.
 

Description
Product No.
ViralXpress DNA/RNA Extraction Reagent
3095
Guanidine hydrochloride, for molecular biology, ≥99%
G3272
Guanidine hydrochloride, ≥99% (titration)
G4505
Guanidine hydrochloride, BioUltra, for molecular biology, ≥99.5% (AT)
50933

For Research Use Only. Not for Diagnostic of in vivo use.

  • Transcriptor One-Step RT-PCR Kit
    Utilizing hot start one-step RT-PCR technology, Transcriptor One-Step RT-PCR Kit includes a mixture of enzymes, including Taq DNA polymerase and a proofreading polymerase, to ensure sensitive and robust reverse transcription. Except for template and primers, Transcriptor One-Step RT-PCR Kit provides all the components required for one-step RT-PCR.
  • KAPA PROBE FAST One-Step
    KAPA PROBE FAST One-Step is designed for high-throughput, fast-cycling, one-step RNA quantification. KAPA PROBE FAST One-Step is suitable for use with all fluorogenic probe-based technologies, including hybridization probes (e.g., FRET), hydrolysis probes (e.g., TaqMan®) and displacement probes (e.g., molecular beacons).
  • Titan™ One Tube RT-PCR System
    Incorporating a mixture of three enzymes, Titan™ One Tube RT-PCR System utilizes reverse transcriptase AMV for first-strand cDNA synthesis and the Expand™ High Fidelity enzyme blend, consisting of Taq DNA polymerase and a polymerase with a proofreading activity, for amplification of cDNA by PCR.
  • Quantitative RT-PCR ReadyMix™
    In addition to containing Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) for first-strand cDNA synthesis, the Quantitative RT-PCR ReadyMix™ is conveniently blended with JumpStart Taq DNA polymerase, 99% pure deoxynucleotides, buffer, stabilizers, and ships as a 2x concentrate.
  • KiCqStart® One-Step Probe RT-qPCR ReadyMix™
    Suitable for all dual-labeled probe chemistries, KiCqStart® One-Step Probe RT-qPCR ReadyMix™ comes with all required components for RT-qPCR, except for RNA template and probe. KiCqStart® One-Step Probe RT-qPCR ReadyMix™ is available with or without ROX™ reference dye.
  • SYBR® Green Quantitative RT-qPCR
    Providing a highly sensitive method for the quantitative analysis of gene expression, this kit combines the advantages of Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) and JumpStart Taq in a convenient ReadyMix.

For Research Use Only. Not for use in diagnostic procedures.
 

 Ultrapure Water

With rapidly evolving and diverse research projects, changing priorities, multiple users and limited space, it’s critical for laboratories to select equipment that is versatile, innovative and flexible to their space requirements. Our Milli-Q® IQ 7000 ultrapure water system and its application filters tick all these boxes.
 

 Essential Products for Molecular Dx & Immunoassay Development

Antibodies for Serology Assay Development

Antibody product range useful for subclassification of human immunoglobulins (IgM, IgG, IgA) in whole blood for serological assay development. Mouse monoclonal anti-Human IgG and IgM validated for use in Lateral Flow Assay and ELISA.
 

Description Product No.
Mouse Anti-Human IgG, monoclonal, validated for use in Lateral Flow Assay and ELISA
MABX1901
Mouse Anti-Human IgM, monoclonal, validated for use in Lateral Flow Assay and ELISA
MABX1911
Goat Anti-Human IgG Antibody, HRP conjugate AP112P
Goat Anti-Human IgG Antibody, HRP conjugate AP309P
Anti-human IgM (μ-chain-specific) HRP A6907
Anti-human IgA (α-chain-specific) HRP A0295

For Research Use Only.  Not for Use in Diagnostic Procedures.
 

Probumin

Diagnostic Grade BSA for protease sensitive immunoassays and as a stabilizing agent for protein reagents requiring low IgG levels; may be used for molecular biology applications. Purity is ≥ 98%; typical purity is 100%.
 

Description Pack Size Product No.
Probumin® Bovine Serum Albumin 1kg 820452
Probumin® Bovine Serum Albumin 5kg 820456
Probumin® Bovine Serum Albumin 100g 820451

Intended for Manufacturing and Development. Not for Human or Animal Consumption. Not for use in Diagnostic procedures.
 

ProClin™ 300

Biocide designed specifically for use within Diagnostics manufacturing applications only. An effective, environmentally-friendly alternative to existing diagnostic reagent preservatives. At recommended usage levels, ProClin™ presents no health hazards, toxicological problems or disposal issues.
 

Description Product No.
ProClin™ 300 48912-U

 

 Key Components for Viral Transport Media

The CDC recently published method for labs to create their own viral transport media. Refer to SOP#: DSR-052-01: Preparation of Viral Transport Media. Specimens can be stored for up to 72 hours at 4℃.
 

 Biosafety Testing Services for Vaccine and Therapy Development

We’re here to partner with you. Our testing facilities are operating and we’re actively engaging the biopharma community to prioritize biosafety testing during this health crisis. Just as we did during Zika, SARS, and Ebola outbreaks, we’re here to support vaccine and therapeutic developers and manufacturers to prioritize therapies. Contact our commercial teams to discuss your needs.

Learn more about our BioReliance® Viral Clearance Studies.

Learn more about our BioReliance® Bulk Harvest Lot Release Testing and BioReliance® Comprehensive Lot Release Testing.

Learn more about our BioReliance® Product Characterization Services.
 

 Virus Characterization

Effective vaccines and therapies start with reliable virus characterization. Reagents and labware relevant for the study of viral attachment and entry, viral genomics, and viral proteomics, and immune response are collected here to facilitate safe, effective work with viruses and other infectious agents.
 

 Virus Attachment & Entry

Early research into the cellular entry mechanism has shown that SARS-CoV-2 uses the angiotensin converter enzyme II (ACE2) receptor for attachment and entry, and the serine protease TMPRSS2 for S protein priming. Find monoclonal and polyclonal antibodies and small molecules specific for relevant viruses and the receptors known to be exploited by them for cellular attachment and entry, including ACE2.

Cell Lines for Virus Propagation

Cell lines used to study SARS CoV viral attachment and propagation include Vero variants, Huh-7D 12 and Caco-2, and are available below.

For information on using cell lines for viral propagation, read about Cell Lines for Virus Culture and Vaccine Production.
 

Description Product No.
Vero C1008 African green monkey kidney Cell LIne, Clone E6 85020206-1VL
VeroCCL81 cell line 84113001
VeroCCL81 cell line (animal-component free) 08011101
16HBE14o- Human Bronchial Epithelial Cell Line SCC150
CACO-2 Human Cell Line 86010202
CACO-2 Cell Line human (intestinal permeability characteristics tested) 09042001
Huh-7D12 Cell Line human (expresses ACE2 receptor) 01042712
293T cell line human 12022001
Human Small Airway Epithelial Cells (HSAEpC) Primary human cells (optimized media also available) C-12642
Huh-7D 12 cell line, human 01042712-1VL
ACE2 Inhibitor, MLN-4760 5306160001
Angiotensin Converting Enzyme-2, ACE2 SAE0064
Anti SARS Antibody S-Specific Clone 154C MAB8783
Anti-ACE2 antibody produced in rabbit, Prestige Antibodies® (Enhanced Validation)
Immunogen: ACE2 PrEST
Applications: WB, IHC
HPA000288
Anti-ACE2 antibody produced in rabbit
Immunogen: Synthetic peptide directed towards the middle region of human ACE2
Applications: IF, IHC, ELISA, WB
SAB3500346
Anti-ACE2 antibody produced in rabbit
Immunogen: Synthetic peptide directed towards the middle region of human ACE2
Applications: WB, IHC
SAB2100025
Anti-ACE2 antibody produced in rabbit
Immunogen: Synthetic peptide directed towards the N-terminus of human ACE2
Applications: IF, IHC, ELISA, WB
SAB3500978
Anti-ACE2 antibody produced in rabbit
Immunogen: Synthetic peptide directed towards the C-terminus of human ACE2
Applications: IF, IHC, ELISA, WB
SAB3500977
Anti-ACE2 antibody, clone 4G5.1 MABN59
ANTI-BAT1(C-TERMINAL) SAB1307254
Anti-CD209 SAB1407409
Anti-SARS Antibody, M Specific MAB8787
Anti-TMPRSS2 antibody produced in rabbit, Prestige Antibodies® HPA035787

 

 RT-PCR Analysis

Reagent and tools for virus genetics collected here include NAP kits for viral RNA purification, high-efficiency systems for RT-PCR and quantitative RT-PCR, cDNA synthesis kits, and more. One-step kits can simplify and accelerate gene amplification across a wide dynamic range.
 

Description Product No.
One Step RT-PCR Master Mix Kit 71978
Transcriptor One-Step RT-PCR Kit TOSRTRO
Transcriptor High Fidelity cDNA Synthesis Kit
THIFICDNARO
Titan One Tube RT-PCR System 11855476001
KiCqStart® One-Step Probe RT-qPCR ReadyMix™ KCQS07
KAPA PROBE FAST One-Step KK4752
M-MLV Reverse Transcriptase M1302
RNAseZAP™ R2020
SYBR® Green JumpStart™ Taq ReadyMix™ S4438
TRI reagent T9424
SYBR® Green Quantitative RT-qPCR Kit QR0100
Quantitative RT-PCR ReadyMix™ QR0200
Milli-Q® IQ 7000 Water System
ZIQ7000T0
BioPak® application pak CDUFBI001

 

 Viral Protein Research Tools

Protein-protein interaction studies have recently been identified as important for SARS-CoV-2 research. Duolink™ PLA (Proximity Ligation Assay) can be used to confirm endogenous protein-protein interaction in cells and tissues with a microscopy or flow cytometry readout.

Affinity gels and columns, plus ready-to-use buffer for cell lysis provide rapid extraction of viral proteins on accelerated timelines, with accurate results. Learn how western blot can be used to confirm virus purification. Learn how western blot can be used to confirm virus purification.
 

Description Product No.
Duolink™ In Situ Red Starter Kit Mouse/Rabbit
DUO92101-1KT
Duolink™ In Situ Orange Starter Kit Mouse/Rabbit
DUO92102-1KT
Duolink™ flowPLA Detection Kit - Green DUO94002-40TST
HIS-Select® Nickel Affinity Gel P6611
Protein A-Sepharose® P3391
RIPA Buffer R0278
BIOshell Glycan, 2.7 μm HPLC Column
50994-U
BIOshell™ A160 Peptide C18, 2.7 μm HPLC Column 66905-U
Acetonitrile, for UHPLC-MS 900667
Water, for UHPLC-MS 900682
Methanol, for UHPLC-MS 900688
Formic acid for LC-MS LiChropur® 5.33002
Difluoroacetic acid for LC-MS LiChropur® 00922
SOLu-Trypsin EMS0004
PNGase Fast EMS0001
α-Cyano-4-hydroxycinnamic acid for MALDI-MS, Ultra pure 39468
Acetonitrile for UHPLC-MS LiChrosolv® 1.03725
Methanol for UHPLC-MS LiChrosolv® 1.03726
Water for UHPLC-MS LiChrosolv® 1.03728
Acetonitrile + 0.1% Formic acid (v/v) hypergrade for LC-MS LiChrosolv® 1.59002
Water + 0.1% Formic acid (v/v) hypergrade for LC-MS LiChrosolv® 1.59013
3-Hydroxypicolinic acid, matrix substance for MALDI-MS 56197

 

 Gene Editing

Find reagents here for shRNA or CRISPR approaches for knockdown or knockout of the ACE2 receptor and other genes relevant to SARS-CoV-2, available in plasmid, lentiviral and synthetic formats.

For additional information on viral gene editing, please visit our advanced genomics page.

shRNA ACE2

CRISPR ordering

Explore our Functional Genomics CRISPR and RNAi Libraries to find screening tools to determine which genes make cells more susceptible or resistant to COVID-19 infection, replication, and progression, which could lead to the development of genetic tests that can be used as secondary diagnostics when assessing risk of COVID-19 complications as well as risk of infection.
 

 Immunology

Patient immune response to COVID-19 infection is variable and may contribute to negative clinical outcomes. Hyperinflammatory response can lead to cytokine storm syndrome (CSS), with significant impact on disease severity. Cytokines and Milliplex® multiplex cytokine/chemokine detection panels provide comprehensive understanding of the inflammatory response for both human and non-human primate samples.
 

Description Product No.
MILLIPLEX® MAP Human Cytokine/Chemokine/Growth Factor Panel A - Immunology Multiplex Assay HCYTA-60K
MILLIPLEX® MAP Human Cytokine/Chemokine/Growth Factor Panel A 38 Plex Premixed Magnetic Bead Panel - Immunology Multiplex Assay HCYTA-60K-PX38
MILLIPLEX® MAP Human Cytokine/Chemokine/Growth Factor Panel A 38 Plex Premixed Magnetic Bead Panel – BULK (Space Saver) PACKAGING - Immunology Multiplex Assay HCYTA-60K-PXBK38
MILLIPLEX® MAP Human Cytokine/Chemokine/Growth Factor Panel A 48 Plex Premixed Magnetic Bead Panel - Immunology Multiplex Assay HCYTA-60K-PX48
MILLIPLEX® MAP Human Cytokine/Chemokine/Growth Factor Panel A 48 Plex Premixed Magnetic Bead Panel – BULK (Space Saver) PACKAGING - Immunology Multiplex Assay HCYTA-60K-PXBK48
IFN-alpha 2b human
recombinant, expressed in E. coli, ≥98% (SDS-PAGE), ≥98% (HPLC)
SRP4595
Interferon β from mouse
≥95%, recombinant, expressed in E. coli, buffered aqueous solution, suitable for cell culture
I9032
Interferon-γ human
IFN-gamma, recombinant, expressed in HEK 293 cells, suitable for cell culture, endotoxin tested
I17001
Interleukin-2 human
IL-2, recombinant, expressed in HEK 293 cells, suitable for cell culture, endotoxin tested
I17002
Interleukin-7 human
≥98% (SDS-PAGE), recombinant, expressed in E. coli, lyophilized powder, suitable for cell culture
I5896
IL-10 human
Animal-component free, recombinant, expressed in E. coli, ≥98% (SDS-PAGE), ≥98% (HPLC)
SRP3312
Granulocyte colony-stimulating factor human
G-CSF, recombinant, expressed in E. coli, suitable for cell culture
G0407
Interferon-γ-Inducible Protein-10 human
≥97% (SDS-PAGE), recombinant, expressed in E. coli, lyophilized powder
I3400
MCP-1/MCAF human
Animal-component free, recombinant, expressed in E. coli, ≥98% (SDS-PAGE), ≥98% (HPLC), suitable for cell culture
SRP3109
Tumor Necrosis Factor-α human
TNF-α, recombinant, expressed in HEK 293 cells, suitable for cell culture
H8916
Interferon Alpha 2A human
recombinant, expressed in HEK 293 cells, ≥98% (SDS-PAGE), lyophilized powder
SRE0013
IFN-alpha 1 human
recombinant, expressed in E. coli, ≥95% (SDS-PAGE), ≥95% (HPLC)
SRP4596
IFN-alpha 2a human
recombinant, expressed in E. coli, ≥95% (SDS-PAGE), ≥95% (HPLC)
SRP4594

 

 Biosafety Testing Services

We’re here to partner with you. Our testing facilities are operating and we’re actively engaging the biopharma community to prioritize biosafety testing during this health crisis. Just as we did during Zika, SARS, and Ebola outbreaks, we’re here to support vaccine and therapeutic developers and manufacturers to prioritize therapies.

Learn more about our BioReliance® Cell Line Characterization Services.

Learn more about our BioReliance® Product Characterization Services.

Learn more about our BioReliance® Viral Clearance Studies.

Learn more about our BioReliance® Bulk Harvest Lot Release Testing and BioReliance® Comprehensive Lot Release Testing.

Learn more about our BioReliance® Next Generation Sequencing (NGS).

Learn more about our BioReliance® Blazar Rapid Molecular Detection Platform.

 Vaccine Production

Effective quality assurance, constant quality control and accurate results are key to manufacturing safe therapies. Our complete solutions for microbial bioburden, sterility and mycoplasma testing as well as environmental monitoring help you meet the highest quality standards and regulatory demands.
 

 Upstream

Our upstream portfolio includes single-use bioreactors, cell culture media, media supplements, critical raw materials, buffers, mixers and a full range of filtration technologies to prevent microbial contamination and ensure your process meets yield and productivity targets.
 

Description Product No. Process Step
CellPrime® rTrypsin 1.06301.0001 Cell Culture
EX-CELL® MDCK Serum-Free Medium for MDCK Cells 24581C-10L Seed Train
Mobius® Single-Use 3L Bioreactor CR0003L200 Bioreactor
Viresolve Barrier Micro Process Development Kit VBMSPDKNB9 Upstream Virus Filtration
Millipore Express® SHR with prefilter membrane in 25 mm Optiscale® devices SHVEA25NB6 Upstream Sterile Filtration
Millipore Express® SHC membrane in 25 mm Optiscale® devices SHGEA25NB6 Upstream Sterile Filtration
ALiCE Cell-Free Protein Expression Kit
AL0103000
Antigen Generation

 

 Downstream

From scale-up to full-scale production, we offer a range of filtration technologies, buffers, CIP solutions, stainless and single-use systems, integrated technologies as well as validation services. Coupled with our in-house application experts who have decades of know-how, we can help you tackle any downstream processing challenge.
 

Description Product No. Process Step
Millistak+ Pod Depth Filter, CE50 media series, 0.027 m2 surface area, 1/4 in. Hose Barb connection MCE50027H1 Harvest / Clarification
Millistak+ Depth Filter in µPod format, CE50 media series, 23 cm2 surface area, Luer fitting connection MCE5023CL3 Harvest / Clarification
Optiscale Capsule Polysep II 1.0/0.5 µm 1/4 in. HB/HB SGW6A47HH3 Harvest / Clarification
Millistak+ Depth Filter in µPod format, D0HC media series, 23 cm2 surface area, Luer fitting connection MD0HC23CL3 Harvest / Clarification
Millistak+ HC Pod Depth Filter, D0HC media series, 0.027 m2 surface area, 1/4 in. Hose Barb connection MD0HC027H1 Harvest / Clarification
Pellicon XL Filter Module Durapore 0.45 µm 50c m2 PXHVMPC50 Harvest / Clarification
Polysep™ II 1.0/0.2/0.1 µm SGW1A47HH3 Harvest / Clarification
Milligard® 0.2 µm SW03A47HH3 Harvest / Clarification
Milligard® PES 1.2/0.2 µm nominal SMP2A25NB6 Harvest / Clarification
Triton X-100 1.08643.1000 Virus Inactivation
Benzonase® suitable for biopharmaceutical production EMPROVE® bio 1.01697 Nuclease
Benzonase® suitable for biopharmaceutical production EMPROVE® bio 1.01695 Nuclease
Benzonase® ELISA kit II for the immunological detection of Benzonase® 1.01681 Nuclease
Pellicon XL Ultrafiltration Module Biomax 300 kDa 0.005 m2 PXB300C50 Ultrafiltration / Diafiltration
Pellicon® 2 Mini Ultrafiltration Module Biomax-100 C 0.1 m 2 P2B100C01 Ultrafiltration / Diafiltration
Pellicon® 2 Mini Ultrafiltration Module Biomax-300 C 0.1 m 2 P2B300C01 Ultrafiltration / Diafiltration
MiniChrom Column Eshmuno® Q, 5 ml 1.25074.0001 Capture Chromatography
NatriFlo HD-Q Recon Mini NXF-01 Capture Chromatography
NatriFlo HD-Q Pilot NXF-10 Capture Chromatography
MiniChrom Column Fractogel DEAE (M), 5 ml 1.25079.0001 Polish Chromatography
MiniChrom Column Fractogel TMAE (M), 5 ml 1.25069.0001 Polish Chromatography
Durapore®  0.22 µm membrane in 25 mm Optiscale® devices SVGLA25NB6 Downstream Sterile Filtration
Millipore Express® SHC membrane in 25 mm Optiscale® devices SHGEA25NB6 Downstream Sterile Filtration

 

 Formulation

Our extensive portfolio of process chemicals, excipients and lipids are designed for high-risk applications like vaccine formulation. Our innovative polymers and lipidic drug delivery excipients feature superior characteristics that ease formulation processes, including squalene and customized lipids manufacturing. Much of our process chemicals portfolio falls under our Emprove® Program, which provides comprehensive regulatory documentation to simplify and speed up regulatory filings. Find our biomolecule formulation excipients list by application here.
 

 Biosafety Testing Services

We’re here to partner with you. Our testing facilities are operating and we’re actively engaging the biopharma community to prioritize biosafety testing during this health crisis. Just as we did during Zika, SARS, and Ebola outbreaks, we’re here to support vaccine and therapeutic developers and manufacturers to prioritize therapies. Contact our commercial teams to discuss your needs.

Learn more about our BioReliance® Viral Clearance Studies.

Learn more about our BioReliance® Bulk Harvest Lot Release Testing and BioReliance® Comprehensive Lot Release Testing.

Learn more about our BioReliance® Product Characterization Services.

Learn more about our BioReliance® Cell Banking and Biorepository Services.

BioReliance® Vaccine Bulk Harvest Testing

Biosafety testing of vaccine bulk harvest and control cells involves a range of tests to demonstrate freedom from adventitious agents (bulk harvest and control cells) and to confirm identity of the vaccine material (bulk harvest). The choice of tests should be based on a viral safety risk assessment as well as relevant regulations and guidance documents and will typically address the following key areas:

  • Detection and identification of vaccine gene of interest
  • Vaccine virus titre
  • Sterility, Mycoplasma and Mycobacterium
  • Neutralization of vaccine virus for cell and in vivo based adventitious virus tests
  • Adventitious viruses

Tests can be performed using a range of methods, from traditional cultivation and sequencing assays to state-of-the art rapid methods employing novel molecular methods such as Next Generation Sequencing and degenerate PCR. Contact info@bioreliance.com to discuss your needs.
 

 Cell Line Characterization

Learn more about our BioReliance® Cell Line Characterization Services.

Learn more about our BioReliance® Product Characterization Services.

Learn more about our BioReliance® Viral Clearance Studies.

Learn more about our BioReliance® Bulk Harvest Lot Release Testing  and BioReliance® Comprehensive Lot Release Testing.

Learn more about our BioReliance® Next Generation Sequencing (NGS).

Learn more about our BioReliance® Blazar Rapid Molecular Detection Platform.

BioReliance® Vaccine Efficacy Studies

Vaccine efficacy studies are performed to establish the ability of the vaccine to induce a protective response. These should be performed before the first in man clinical studies. These studies normally require immunisation into a suitable model system and demonstrating an immune response using firstly ELISA methods and then demonstrating the immune response is protective by using viral neutralization methods. These methods can then be modified and used as potency release assays for releasing each batch of clinical product, as well as a stability indicating method for stability studies. Contact info@bioreliance.com to discuss your needs.
 

 Quality Control and Environmental Monitoring

Effective quality assurance, constant quality control and accurate results are key to manufacturing safe therapies. Our complete solutions for microbial detection and sterility assurance help you meet the highest quality standards and regulatory demands.
 

Product Type
Milliflex Oasis® Filtration System Microbial Bioburden
Milliflex® Quantum Rapid Detection Microbial Bioburden
Steritest™ NEO Sterility Testing Solutions
Steritest Media and Rinsing Fluids Sterility Testing Solutions
Steritest™ Symbio Pumps Sterility Testing Solutions
PyroMAT™ System
Pyrogen Testing
Active Air Monitoring- MAS-100® Family/RCS® Series Environmental Monitoring
Air Monitoring Media- Contact Plates, HYCON® Agar Strips, M Air T® Cassettes, Settle Plates Environmental Monitoring
Passive Air Monitoring- ICR and LI Settle Plates Environmental Monitoring
Surface & Personnel Monitoring- Contact Plates, HYCON® Contact Slides, ICR Swabs Environmental Monitoring
Settle Plates for Active and Passive Air Monitoring ICR LI
Environmental Monitoring
Microbial Air Samplers MAS for Isolators in the Pharmaceutical Industry
Environmental Monitoring
Microbial Air Samplers for Isolators in the Pharmaceutical Industry
Environmental Monitoring
Contact Plates for Personnel and Surface Monitoring ICR RT Environmental Monitoring
Media Fill Testing in the Pharmaceutical Industry
Environmental Monitoring
Milli-Q® IQ 7000 Water System Ultrapure Water
BioPak® application pak Ultrapure Water

 

 Screening

Screening can directly identify drug targets for treating COVID via anti-virals and also aid in identification of targets within producer cell lines that can then be engineered to more efficiently produce virus/viral particle vaccines at a larger scale. Explore our Functional Genomics CRISPR and RNAi Libraries.

 Development and Manufacturing Services

World-class process development and manufacturing for virus-based therapeutic products. From small scale toxicology and Phase I material to commercial-scale manufacturing and fill finish, our flexible facilities and expert staff are leaders in viral product manufacturing. Learn more about our BioReliance® Viral and Gene Therapy Manufacturing.

With extensive experience in producing customized cell lines for enhancing viral vaccine production, our cell engineering services enable you to produce higher levels of vaccine titer and scalable production cell lines. We will work with the parental cell line of your choice to generate your desired modifications.

 Analytical Methods for Nucleic Acid Vaccine

Nucleic Acid Vaccines - Product and process related impurities

A variety of analytical methods are available to assess product purity. Typically, these will include a combination of orthogonal separation techniques, such as chromatography (RP-HPLC, SEC, IEX) and electrophoresis (CE-SDS). Additional assays can be employed to test for impurities specific to the particular product or process. For example, residual enzymes and DNA in RNA based products. Contact info@bioreliance.com to discuss your needs.
 

 Therapy Production

Effective quality assurance, constant quality control and accurate results are key to manufacturing safe therapies. Our complete solutions for microbial bioburden, sterility and mycoplasma testing as well as environmental monitoring help you meet the highest quality standards and regulatory demands.
 

 Small Molecule Therapeutics

Classical Pharmaceutical Formulation & Manufacturing

Finding a robust formulation, complying with regulatory requirements, and adhering to quality standards are all top priorities when manufacturing an anti-viral or other small molecule drug.

Based on our expertise in this industry, we understand your challenges in development and manufacturing of small molecule pharmaceuticals and formulation and can support you with products and services. Click here to find out more about our portfolio and access relevant technical resources.

Comprehensive End to End Solutions for Genotoxicity Assessment

BioReliance® offers genetic toxicology services for the detection of toxic, mutagenic, clastogenic and morphological transforming activity in a number of well-characterized test systems. Our scientific staff and state-of-the-art facilities provide the most current and comprehensive genetic toxicology resources available anywhere.

 Analysis of Antivirals and other therapeutic drug candidates

Therapeutic drugs must be tested – from drug development to Quality Control (QC) of the active pharmaceutical ingredient as well as the final formulation. Our offering comprises products for Analysis such as: Standards and Reference Materials, HPLC and UHPLC Columns and accessories, TLC products, GC, Solvents, Buffers and Reagents, Sample preparation, Filtration, Water Purification Solutions  and many more.

Various drugs1 are currently under investigation as to whether they are effective treatment for COVID-19, including Lopinavir, Ritonavir2, Chloroquine3, and Fingolimod4 for which we can offer the CRMs and the primary compendial standards.
 

List of CRMs and the primary compendial standards Product No.
Lopinavir United States Pharmacopeia (USP) Reference Standard 1370101
Lopinavir European Pharmacopoeia (EP) Reference Standard Y0001498
Lopinavir Pharmaceutical Secondary Standard; Certified Reference Material PHR1927
Ritonavir United States Pharmacopeia (USP) Reference Standard 1604803
Ritonavir European Pharmacopoeia (EP) Reference Standard Y0000714
Ritonavir British Pharmacopoeia (BP) Reference Standard BP1210
Ritonavir Pharmaceutical Secondary Standard; Certified Reference Material PHR1734
Chloroquine phosphate United States Pharmacopeia (USP) Reference Standard 1118000
Chloroquine phosphate Pharmaceutical Secondary Standard; Certified Reference Material PHR1258
Fingolimod Hydrochloride United States Pharmacopeia (USP) Reference Standard 1270480
Fingolimod hydrochloride European Pharmacopoeia (EP) Reference Standard Y0002055

 

 Plasma-Derived Therapies

Plasma manufacturers are investigating plasma therapies as a treatment for COVID-19. Plasma production processes are highly variable depending on the production platform utilized. Please visit our Plasma Resource Center for information on common challenges in manufacturing plasma-derived therapies and how we can help you overcome them.

Please see our brochure for an overview of the products and services we have to support plasma-derived therapy manufacturing.

Relevant chromatography and TFF products for plasma can be found below.
 

Description Product No.
ESHMUNO P anti-A 1.20094
ESHMUNO P anti-B 1.20095
Fractogel EMD TMAE (M) 1.16881
Fractogel EMD TMAE (S) 1.16887
Fractogel EMD TMAE Hicap (M) 1.10316
Fractogel EMD TMAE Medcap (M) 1.16885
Pellicon 3 Cassettes
 
Viresolve® Pro Solution VPMNVALNB9
Viresolve®  Pro Micro Shield kit VPMSKITNB9
Viresolve®  Pro Micro Shield H kit VPMHKITNB9

 

 Monoclonal Antibodies

mAb CDMO Services: BioReliance® End-to-End Solutions

Your biotech company has discovered a promising molecule with the potential to develop a biologics drug against COVID-19? If you don’t have the in-house resources and capacity, we can develop and manufacture your treatment for you; offering a flexible model for engagement that can include fast-track development and no upfront payment or booking fees. Our adaptive CDMO solutions allow you to more effectively manage project risks and manage uncertainty, guiding you from cell line development and process development to GMP manufacturing.

Explore our end-to-end MaB manufactring portfolio.
 

Products for mAb Manufacturing

From upstream to downstream, single-use or stainless steel, traditional or intensified processing, we have the full portfolio of chemicals, systems, and consumables to help you produce your monoclonal antibody.  

Explore our portfolio for every step of your mAb manufacturing.
 

 Quality Control and Environmental Monitoring

Effective quality assurance, constant quality control and accurate results are key to manufacturing safe therapies. Our complete solutions for microbial detection and sterility assurance help you meet the highest quality standards and regulatory demands.
 

Product Type
Milliflex Oasis® Filtration System Microbial Bioburden
Milliflex® Quantum Rapid Detection Microbial Bioburden
Steritest™ NEO Sterility Testing Solutions
Steritest Media and Rinsing Fluids Sterility Testing Solutions
Steritest™ Symbio Pumps Sterility Testing Solutions
PyroMAT™ System Pyrogen Testing
Active Air Monitoring- MAS-100® Family Environmental Monitoring for Microbiology
Air Monitoring Media- HYCON® Agar Strips, Settle Plates Environmental Monitoring for Microbiology
Passive Air Monitoring- ICR and LI Settle Plates Environmental Monitoring for Microbiology
Surface & Personnel Monitoring- Contact Plates, HYCON® Contact Slides, ICR Swabs Environmental Monitoring for Microbiology
Settle Plates for Active and Passive Air Monitoring ICR LI Environmental Monitoring for Microbiology
Microbial Air Samplers MAS for Isolators in the Pharmaceutical Industry Environmental Monitoring for Microbiology
Microbial Air Samplers for Isolators in the Pharmaceutical Industry Environmental Monitoring for Microbiology
Contact Plates for Personnel and Surface Monitoring ICR RT Environmental Monitoring for Microbiology
Media Fill Testing in the Pharmaceutical Industry Environmental Monitoring
Milli-Q® IQ 7000 Water System
Ultrapure Water
BioPak® application pak Ultrapure Water

 

 Biosafety Testing Services

We’re here to partner with you. Our testing facilities are operating and we’re actively engaging the biopharma community to prioritize biosafety testing during this health crisis. Just as we did during Zika, SARS, and Ebola outbreaks, we’re here to support vaccine and therapeutic developers and manufacturers to prioritize therapies.

Learn more about our BioReliance® Cell Line Characterization Services.

Learn more about our BioReliance® Product Characterization Services.

Learn more about our BioReliance® Viral Clearance Studies.

Learn more about our BioReliance® Bulk Harvest Lot Release Testing and BioReliance® Comprehensive Lot Release Testing.

BioReliance® Vaccine Bulk Harvest Testing

Biosafety testing of vaccine bulk harvest and control cells involves a range of tests to demonstrate freedom from adventitious agents (bulk harvest and control cells) and to confirm identity of the vaccine material (bulk harvest). The choice of tests should be based on a viral safety risk assessment as well as relevant regulations and guidance documents and will typically address the following key areas:

  • Detection and identification of vaccine gene of interest
  • Vaccine virus titre
  • Sterility, Mycoplasma and Mycobacterium
  • Neutralization of vaccine virus for cell and in vivo based adventitious virus tests
  • Adventitious viruses

Tests can be performed using a range of methods, from traditional cultivation and sequencing assays to state-of-the art rapid methods employing novel molecular methods such as Next Generation Sequencing and degenerate PCR. Contact info@bioreliance.com to discuss your needs.
 

 Novel Modalities

Nucleic Acid Vaccines - Product and process related impurities

A variety of analytical methods are available to assess product purity. Typically, these will include a combination of orthogonal separation techniques, such as chromatography (RP-HPLC, SEC, IEX) and electrophoresis (CE-SDS). Additional assays can be employed to test for impurities specific to the particular product or process. For example, residual enzymes and DNA in RNA based products. Contact info@bioreliance.com to discuss your needs.
 

 Virus & Viral-Like Therapies

Learn more about BioReliance® Virus Bank Characterization.

Learn more about our BioReliance® Cell Line Characterization Services.

Learn more about our BioReliance® Product Characterization Services.

Learn more about our BioReliance® Viral Clearance Studies.

Learn more about our BioReliance® Bulk Harvest Lot Release Testing and BioReliance® Comprehensive Lot Release Testing.

Learn more about our BioReliance® Cell Banking and Biorepository Services.

BioReliance® Vaccine Bulk Harvest Testing

Biosafety testing of vaccine bulk harvest and control cells involves a range of tests to demonstrate freedom from adventitious agents (bulk harvest and control cells) and to confirm identity of the vaccine material (bulk harvest). The choice of tests should be based on a viral safety risk assessment as well as relevant regulations and guidance documents and will typically address the following key areas:

  • Detection and identification of vaccine gene of interest
  • Vaccine virus titre
  • Sterility, Mycoplasma and Mycobacterium
  • Neutralization of vaccine virus for cell and in vivo based adventitious virus tests
  • Adventitious viruses

Tests can be performed using a range of methods, from traditional cultivation and sequencing assays to state-of-the art rapid methods employing novel molecular methods such as Next Generation Sequencing and degenerate PCR. Contact info@bioreliance.com to discuss your needs.

 ATP Testing & Sanitation

Recent studies of the NIH showed that viable viruses can be detected after 2-3 days. The MVP Icon® is a quick and easy-to-use system to check effectiveness of cleaning and disinfection procedures, even if viruses like SARS-CoV-2 are not directly measured. The MVP ICON® measures the amount of adenosine triphosphate (ATP) in surface samples, an indicator of environmental contamination. Results are obtained in less than a minute and securely documented for subsequent evaluation. The MVP Icon® helps you and your staff in a fast and easy way to monitor the success of cleaning and disinfection procedures.
 

Description
Product No.
MVP Icon® 78300BC
MVP Surface Sampling Device 64003-100

 

 Labware

Our Labware partner brands are chosen to bring our customers the best products from around the industry with easy access and seamless ordering for all of your PCR and RT-PCR needs.
 

Description Product No.
PCR strip tubes, thin wall, 8 per strip, 0.2 mL AXYPCR0208A
Corning® Thermowell GOLD PCR 8 well tube strips CLS3740
Corning® microcentrifuge tubes with screw cap, 1.5 mL CLS430909
Eppendorf® Flex-Tubes Microcentrifuge Tubes, 1.5mL EP022363514
Corning® Axygen® PCR Microplate AXYPCR96C
Corning® 96 well protein crystallization plates CLS3550
Pipette filter tips, universal fit, size 100 μL AXYTF100
Corning® DeckWorks™ barrier pipet tips, 0.1 - 10μL CLS4135
Eppendorf® ep Dualfilter T.I.P.S.® SealMax G, 0.1-10 μL EP0030077806
Corning® CoolRack®, XT-M-PCR, 12 x 1.5 or 2 mL microfuge tubes and 6 strip wells CLS432054
Corning® LSE™ mini microcentrifuges, AC/DC input 110 - 240 V CLS6770
Eppendorf® MiniSpin®, with rotor F-45-12-11, for 1.5-2.0 mL tubes, AC/DC input 120 V EP022620100
Eppendorf Research® plus Pipette, fixed volume, single-channel, volume 10 μL EP3124000024
Eppendorf Research® Plus G, 3-pack, option 2, 2-20 uL/20-200 uL/100-1000 uL, includes epT.I.P.S.® box EP3123000918
Eppendorf Research® Plus G, 12-channel, variable, volume (0.5-10 μL) EP3125000028
Eppendorf® Tube Rack for 1.5 and 2.0 mL Tubes, Holds 36 x 1.5-2 mL tubes EP0030119819
Millicell® Hanging Cell Culture Insert, PET 0.4 μm, 12-well, 48/pk MCHT12H48
Strips of 8 PCR tubes, PP, attached transparent single caps, 0,2 ml, Standard, white tubes BR781316
96-well PCR plate, semi-skirted, raised skirt, low profile, white, blue coding, cut corner A1, PP
BR781374
Sealing film for microplates, Polyester, pressure sensitive, for ELISA and Real-Time PCR
BR781391
Transferpette® S, 0,5-10 µl, adjustable volume, D-10, DE-M
BR705870
Transferpette® S, 0,1-2,5 µl, adjustable volume, D-2,5, DE-M
BR705869
96-well PCR plate, skirted, low profile, white, black coding, cut corner A12, PP
BR781378