Quantitative PCR Protocols
Although quantitative PCR uses the same basic concept as traditional PCR, the reactions differ in that the amplicons are generally smaller and are detected indirectly using an additional dye or labeled probe or primer.
The SPUD assay is one option for identification of inhibitors that may be present in RNA or DNA samples. The assay is particularly useful when a large number of samples are to be analyzed or when targets are present at low copy number making dilution of the sample impractical. The test is used to avoid false negatives and to lend greater confidence to reporting of data based on a negative result.
The SPUD assay consists of an artificial template and two primers that are specific to the template and is run in the presence of SYBR® Green I dye or a template specific probe. During the assay, the SPUD template is amplified, resulting in a characteristic Cq. Alongside this control reaction, the artificial template is spiked into samples and measured in comparison to the control. In the presence of a clean sample, the Cq will remain the same as the SPUD control whereas in the presence of a contaminated sample, the Cq will shift to higher cycles.
Table P8-20. SPUD Assay Oligo Sequences.
Primer | Sequence (5’-3’) |
SPUD Template | AACTTGGCTTTAATGGACCTCCAATTTTGAGTGTGCACAAGCTATGGAA CACCACGTAAGACATAAAACGGCCACATATGGTGCCATGTAAGGATGAATGT |
SPUD Forward | AACTTGGCTTTAATGGACCTCCA |
SPUD Reverse | ACATTCATCCTTACATGGCACCA |
1. Place all reaction components on ice.
2. Mix and then centrifuge briefly to collect contents at the bottom of the tube.
3. Determine the total number of samples to be tested in duplicate and also allow for two No Test Sample Controls.
4. Prepare master mix for all samples and controls according to Table P8-21 allowing 10% extra to allow for pipetting
error. Mix well.
Table P8-21. qPCR Master Mix for SPUD Inhibitor Test.
Reagent | Volume (μL) per Single 25 μL Reaction |
2× KiCqStart® ReadyMix | 12.5 |
SPUD Primer F (10 μM stock | 0.25 |
SPUD Primer R (10 μM stock) | 0.25 |
SPUD template (pre diluted to 20,000 copies/μL) | 1 |
Reference dye (instrument specific, see Table P4-7) | 1 |
PCR grade water | 5 |
5. Aliquot 20 μL of SPUD qPCR master mix into the sample tubes/wells. If using a PCR plate, follow a plate schematic to
ensure that the reagents, samples and controls are added to the right wells.
6. Aliquot 5 μL cDNA sample into qPCR tubes/wells and 5 μL water to the No Test Sample Control tubes/wells.
7. Cap tubes or seal the PCR plate and label. (Make sure the labeling does not obscure instrument excitation/detection
light path.)
8. Run samples using the two-step protocol provided below, repeating steps 1–2 for 40 cycles.
Table P8-22. qPCR Cycling Conditions for SPUD Inhibitor Test.
Cycling Conditions | Temp (°C) | Time (sec) |
Initial Hot Start/denaturation | 95 | 30 |
Steps 1–2 are repeated through 40 cycles |
||
Step 1 | 95 | 5 |
Step 2 |
60 |
20 |
Note: Use standards dissociation curve protocol (data collection)